Microsatellites (marker)
This is an example of a microsatellite locus run on an acrylamide gel (not unlike an agarose gel) versus the same locus run on a capillary sequencer. © Krueger-Hadfield 2011
Microsatellites, which are also called simple sequence repeats, are genetic markers used in the Sotka lab. They can be sets of 2, 3, 4 or 5 nucleotide repeats (see DNA section).
ACTGGGTCATGACATGACTATATATATATATATATATATATATATATATAGCTAGCTAGCTGATCGA
The above sequence from a fictional Gracilaria vermiculophylla sample is an example of a microsatellite. The black nucleotides are flanking regions, meaning they are the nucleotides immediately surrounding the microsatellite motif. In this example, the red letters are the microsatellite motif (like a motif or short melody in music). In this case, the motif is at TA repeat. It is repeated 16 times.
The number of repeats will vary between individuals making these markers highly polymorphic, or highly variable.
We determine the length of a microsatellite marker, or locus, by using the capillary sequencer (see Capillary Sequencer section). But, we measure the whole length of the motif plus the basepairs, or nucleotides, that make up the primers.
The primers are in the flanking regions surrounding the motif. They are a specific sequence that will start DNA synthesis during PCR. They will amplify the specific locus we are after.
We use fluorescently labeled primers during PCR for use on the capillary sequencer (see Capillary sequencer section).
Stacy uses these markers to analyze populations of Gracilaria vermiculophylla … both for the invasive history (where did it come from, how is it spreading, etc.), but also questions about reproduction in the native and non-native ranges.
Courtney used these markers to identify her individuals in her G. vermiculophylla mono- and polyculture experiments.
ACTGGGTCATGACATGACTATATATATATATATATATATATATATATATAGCTAGCTAGCTGATCGA
The above sequence from a fictional Gracilaria vermiculophylla sample is an example of a microsatellite. The black nucleotides are flanking regions, meaning they are the nucleotides immediately surrounding the microsatellite motif. In this example, the red letters are the microsatellite motif (like a motif or short melody in music). In this case, the motif is at TA repeat. It is repeated 16 times.
The number of repeats will vary between individuals making these markers highly polymorphic, or highly variable.
We determine the length of a microsatellite marker, or locus, by using the capillary sequencer (see Capillary Sequencer section). But, we measure the whole length of the motif plus the basepairs, or nucleotides, that make up the primers.
The primers are in the flanking regions surrounding the motif. They are a specific sequence that will start DNA synthesis during PCR. They will amplify the specific locus we are after.
We use fluorescently labeled primers during PCR for use on the capillary sequencer (see Capillary sequencer section).
Stacy uses these markers to analyze populations of Gracilaria vermiculophylla … both for the invasive history (where did it come from, how is it spreading, etc.), but also questions about reproduction in the native and non-native ranges.
Courtney used these markers to identify her individuals in her G. vermiculophylla mono- and polyculture experiments.
